mouse myod1 gene (Addgene inc)
Addgene inc is a verified supplier 
85
Structured Review
Addgene inc
mouse myod1 gene
Figures S5 A and S5B. (E) Immunofluorescence staining of differentiation-induced cells with or without guanine on day 7. The experiment was carried out independently from the experiment of (C and D). Blue, Hoechst green, MHC or VSV-N. Images from two additional experiments are shown in Figures S5 C and S5D. Scale bars, 100 μm. " width="250" height="auto" />
Mouse Myod1 Gene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+myod1+gene/LV-TRE-WT+mouse+MyoD-T2A-dsRedExpress2+(Plasmid+%2360624)/pmc11897756-201-16-25
Average 85 stars, based on 2 article reviews
Figures S5 A and S5B. (E) Immunofluorescence staining of differentiation-induced cells with or without guanine on day 7. The experiment was carried out independently from the experiment of (C and D). Blue, Hoechst green, MHC or VSV-N. Images from two additional experiments are shown in Mouse Myod1 Gene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+myod1+gene/LV-TRE-WT+mouse+MyoD-T2A-dsRedExpress2+(Plasmid+%2360624)/pmc11897756-201-16-25
Average 85 stars, based on 2 article reviews
mouse myod1 gene - by Bioz Stars,
2026-09
85/100 stars
Images
1) Product Images from "Scalable control of stem cell fate by riboswitch-regulated RNA viral vector without genomic integration"
Article Title: Scalable control of stem cell fate by riboswitch-regulated RNA viral vector without genomic integration
Journal: Molecular Therapy
doi: 10.1016/j.ymthe.2025.01.005
Figures S5 A and S5B. (E) Immunofluorescence staining of differentiation-induced cells with or without guanine on day 7. The experiment was carried out independently from the experiment of (C and D). Blue, Hoechst green, MHC or VSV-N. Images from two additional experiments are shown in Figure Legend Snippet: Induction of myogenic differentiation by MyoD-VSV (A) RNA genome structure of MyoD-VSV. (B) Schedule of myogenic differentiation of mESCs infected with MyoD-VSV. (C and D) Images and relative mRNA levels of mESCs infected with MyoD-VSV on days −1, 1, 3, 5, and 7. The y axis values indicate relative RNA levels normalized against GAPDH (RQ). Each data point indicates the mean of technical duplicates or triplicates. Error bars indicate the maximum and minimum RQ. Another set of repeated experiments is shown in
Techniques Used: Infection, Immunofluorescence, Staining
Related Articles
Sequencing:Article Title: Scalable control of stem cell fate by riboswitch-regulated RNA viral vector without genomic integration. Article Snippet: The vectors were prepared by ligating appropriate fragments into the MluI and NotI restriction sites, transforming them into NEB Stable Competent E. coli (catalog no. C3040, NEB), and culturing the transformed cells at 30 C in LBmediumwith ampicillin. .. The mouse Nanog sequence was cloned from the total RNA extracted from BRC6 mESCs, and the Article Title: Regulation of Myogenesis by a Na/K-ATPase α1 Caveolin Binding Motif Article Snippet: .. The primer sequences are listed in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Primer Name Primer Sequence (5'→3') human HPRT1 Forward TGGACAGGACTGAACGTCTT human HPRT1 Reverse TCCAGCAGGTCAGCAAAGAA Human MYOD Forward CGACGGCATGATGGACTACA Human MYOD Reverse GGCAGTCTAGGCTCGACAC Human MYOG Forward CCAGGGGATCATCTGCTCACG Human MYOG Reverse GGAAGGCCACAGACACATCT Human MYH8 Forward GCAGACAGAAGCGGGTGAAT Human MYH8 Reverse GCTGAGTAGATGCTTGCTTGC Human MYH3 Forward GAGGCTGGTGAGCTGAGTC Human MYH3 Reverse GCTGCCTCTTGAGCTCTTCT Human TNNT1 Forward ACCTGGTCAAGGCAGAACAG Human TNNT1 Reverse TGTCCAGAGGCTTCTTACGC Human CAV3 Forward ACCTTCTGCAACCCACTCTTC Human CAV3 Reverse GAGCAGTCCCTGGCTTTAGAC Human MYF5 Forward TGAGAGAGCAGGTGGAGAACT Human MYF5 Reverse ACATTCGGGCATGCCATCAGA Human MSGN1 Forward TGTTGGACCCACCAGAACAC Human MSGN1 reverse TTGCAAAGGATGAGCCTCCC Human PAX3 Forward CAAGCCCAAGCAGGTGACAA Human PAX3 reverse TCGGATTTCCCAGCTGAACA Human MIXL1 Forward AGTCCAGGATCCAGGTATGGT Human MIXL1 Reverse GGCCTAGCCAAAGGTTGGAA Human CTNNB1 Forward GGCTACTCAAGCTGATTTGATGG Human CTNNB1 Reverse AAGACTGTTGCTGCCAGTGA Human TBXT Forward GGGTACTCCCAATCCTATTCTGAC Human TBXT Reverse ACTGACTGGAGCTGGTAGGT Human NANOG Forward CAATGGTGTGACGCAGGGAT Human NANOG Reverse TGCACCAGGTCTGAGTGTTC Human OCT4 Forward CGAGAAGGATGTGGTCCGAG Human OCT4 Reverse GAGACAGGGGGAAAGGCTTC Human PPARG Forward GATACACTGTCTGCAAACATATCACAA Human PPARG Reverse CCACGGAGCTGATCCCAA Human FASN Forward TCGTGGGCTACAGCATGGT Human FASN Reverse GCCCTCTGAAGTCGAAGAAGAA Human ADIPOQ Forward TCTGCCTTCCGCAGTGTAGG Human ADIPOQ Reverse GGTGTGGCTTGGGGATACGA Human FABP4 Forward GCTTTGCCACCAGGAAAGTG Human FABP4 Reverse ATGGACGCATTCCACCACCA Mouse Myog Forward GTCCCAACCCAGGAGATCATT Mouse Myog Reverse AGTTGGGCATGGTTTCGTCT Mouse Myod1 Forward TGGCATGATGGATTACAGCGG Mouse Myod1 Reverse GGTGGTGCATCTGCCAAAAG mouse Myh3 Forward CTCTGTCACAGTCAGAGGTGT mouse Myh3 Reverse CTTTTCCGACTTGCGGAGGA mouse Myh8 Forward CTGAGGAGGCTGAGGAACAATC mouse Myh8 Reverse CCTCCTTCCTCTGCAAGATGT Mouse Actb Forward GGCTGTATTCCCCTCCATCG Mouse Actb Reverse CCAGTTGGTAACAATGCCATGT Open in a separate window Primer sequences Lentivirus-mediated gene delivery Lentivirus expression vector for the Article Title: Scalable control of stem cell fate by riboswitch-regulated RNA viral vector without genomic integration Article Snippet: The vectors were prepared by ligating appropriate fragments into the MluI and NotI restriction sites, transforming them into NEB Stable Competent E. coli (catalog no. C3040, NEB), and culturing the transformed cells at 30°C in LB medium with ampicillin. .. The mouse Nanog sequence was cloned from the total RNA extracted from BRC6 mESCs, and the Clone Assay:Article Title: Scalable control of stem cell fate by riboswitch-regulated RNA viral vector without genomic integration. Article Snippet: The vectors were prepared by ligating appropriate fragments into the MluI and NotI restriction sites, transforming them into NEB Stable Competent E. coli (catalog no. C3040, NEB), and culturing the transformed cells at 30 C in LBmediumwith ampicillin. .. The mouse Nanog sequence was cloned from the total RNA extracted from BRC6 mESCs, and the Article Title: Scalable control of stem cell fate by riboswitch-regulated RNA viral vector without genomic integration Article Snippet: The vectors were prepared by ligating appropriate fragments into the MluI and NotI restriction sites, transforming them into NEB Stable Competent E. coli (catalog no. C3040, NEB), and culturing the transformed cells at 30°C in LB medium with ampicillin. .. The mouse Nanog sequence was cloned from the total RNA extracted from BRC6 mESCs, and the Polymerase Chain Reaction:Article Title: Scalable control of stem cell fate by riboswitch-regulated RNA viral vector without genomic integration. Article Snippet: The vectors were prepared by ligating appropriate fragments into the MluI and NotI restriction sites, transforming them into NEB Stable Competent E. coli (catalog no. C3040, NEB), and culturing the transformed cells at 30 C in LBmediumwith ampicillin. .. The mouse Nanog sequence was cloned from the total RNA extracted from BRC6 mESCs, and the Article Title: Scalable control of stem cell fate by riboswitch-regulated RNA viral vector without genomic integration Article Snippet: The vectors were prepared by ligating appropriate fragments into the MluI and NotI restriction sites, transforming them into NEB Stable Competent E. coli (catalog no. C3040, NEB), and culturing the transformed cells at 30°C in LB medium with ampicillin. .. The mouse Nanog sequence was cloned from the total RNA extracted from BRC6 mESCs, and the Expressing:Article Title: Regulation of Myogenesis by a Na/K-ATPase α1 Caveolin Binding Motif Article Snippet: .. The primer sequences are listed in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Primer Name Primer Sequence (5'→3') human HPRT1 Forward TGGACAGGACTGAACGTCTT human HPRT1 Reverse TCCAGCAGGTCAGCAAAGAA Human MYOD Forward CGACGGCATGATGGACTACA Human MYOD Reverse GGCAGTCTAGGCTCGACAC Human MYOG Forward CCAGGGGATCATCTGCTCACG Human MYOG Reverse GGAAGGCCACAGACACATCT Human MYH8 Forward GCAGACAGAAGCGGGTGAAT Human MYH8 Reverse GCTGAGTAGATGCTTGCTTGC Human MYH3 Forward GAGGCTGGTGAGCTGAGTC Human MYH3 Reverse GCTGCCTCTTGAGCTCTTCT Human TNNT1 Forward ACCTGGTCAAGGCAGAACAG Human TNNT1 Reverse TGTCCAGAGGCTTCTTACGC Human CAV3 Forward ACCTTCTGCAACCCACTCTTC Human CAV3 Reverse GAGCAGTCCCTGGCTTTAGAC Human MYF5 Forward TGAGAGAGCAGGTGGAGAACT Human MYF5 Reverse ACATTCGGGCATGCCATCAGA Human MSGN1 Forward TGTTGGACCCACCAGAACAC Human MSGN1 reverse TTGCAAAGGATGAGCCTCCC Human PAX3 Forward CAAGCCCAAGCAGGTGACAA Human PAX3 reverse TCGGATTTCCCAGCTGAACA Human MIXL1 Forward AGTCCAGGATCCAGGTATGGT Human MIXL1 Reverse GGCCTAGCCAAAGGTTGGAA Human CTNNB1 Forward GGCTACTCAAGCTGATTTGATGG Human CTNNB1 Reverse AAGACTGTTGCTGCCAGTGA Human TBXT Forward GGGTACTCCCAATCCTATTCTGAC Human TBXT Reverse ACTGACTGGAGCTGGTAGGT Human NANOG Forward CAATGGTGTGACGCAGGGAT Human NANOG Reverse TGCACCAGGTCTGAGTGTTC Human OCT4 Forward CGAGAAGGATGTGGTCCGAG Human OCT4 Reverse GAGACAGGGGGAAAGGCTTC Human PPARG Forward GATACACTGTCTGCAAACATATCACAA Human PPARG Reverse CCACGGAGCTGATCCCAA Human FASN Forward TCGTGGGCTACAGCATGGT Human FASN Reverse GCCCTCTGAAGTCGAAGAAGAA Human ADIPOQ Forward TCTGCCTTCCGCAGTGTAGG Human ADIPOQ Reverse GGTGTGGCTTGGGGATACGA Human FABP4 Forward GCTTTGCCACCAGGAAAGTG Human FABP4 Reverse ATGGACGCATTCCACCACCA Mouse Myog Forward GTCCCAACCCAGGAGATCATT Mouse Myog Reverse AGTTGGGCATGGTTTCGTCT Mouse Myod1 Forward TGGCATGATGGATTACAGCGG Mouse Myod1 Reverse GGTGGTGCATCTGCCAAAAG mouse Myh3 Forward CTCTGTCACAGTCAGAGGTGT mouse Myh3 Reverse CTTTTCCGACTTGCGGAGGA mouse Myh8 Forward CTGAGGAGGCTGAGGAACAATC mouse Myh8 Reverse CCTCCTTCCTCTGCAAGATGT Mouse Actb Forward GGCTGTATTCCCCTCCATCG Mouse Actb Reverse CCAGTTGGTAACAATGCCATGT Open in a separate window Primer sequences Lentivirus-mediated gene delivery Lentivirus expression vector for the Article Title: Regulation of Myogenesis by a Na/K-ATPase α1 Caveolin Binding Motif Article Snippet: .. Lentivirus expression vector for the Plasmid Preparation:Article Title: Regulation of Myogenesis by a Na/K-ATPase α1 Caveolin Binding Motif Article Snippet: .. The primer sequences are listed in . table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Primer Name Primer Sequence (5'→3') human HPRT1 Forward TGGACAGGACTGAACGTCTT human HPRT1 Reverse TCCAGCAGGTCAGCAAAGAA Human MYOD Forward CGACGGCATGATGGACTACA Human MYOD Reverse GGCAGTCTAGGCTCGACAC Human MYOG Forward CCAGGGGATCATCTGCTCACG Human MYOG Reverse GGAAGGCCACAGACACATCT Human MYH8 Forward GCAGACAGAAGCGGGTGAAT Human MYH8 Reverse GCTGAGTAGATGCTTGCTTGC Human MYH3 Forward GAGGCTGGTGAGCTGAGTC Human MYH3 Reverse GCTGCCTCTTGAGCTCTTCT Human TNNT1 Forward ACCTGGTCAAGGCAGAACAG Human TNNT1 Reverse TGTCCAGAGGCTTCTTACGC Human CAV3 Forward ACCTTCTGCAACCCACTCTTC Human CAV3 Reverse GAGCAGTCCCTGGCTTTAGAC Human MYF5 Forward TGAGAGAGCAGGTGGAGAACT Human MYF5 Reverse ACATTCGGGCATGCCATCAGA Human MSGN1 Forward TGTTGGACCCACCAGAACAC Human MSGN1 reverse TTGCAAAGGATGAGCCTCCC Human PAX3 Forward CAAGCCCAAGCAGGTGACAA Human PAX3 reverse TCGGATTTCCCAGCTGAACA Human MIXL1 Forward AGTCCAGGATCCAGGTATGGT Human MIXL1 Reverse GGCCTAGCCAAAGGTTGGAA Human CTNNB1 Forward GGCTACTCAAGCTGATTTGATGG Human CTNNB1 Reverse AAGACTGTTGCTGCCAGTGA Human TBXT Forward GGGTACTCCCAATCCTATTCTGAC Human TBXT Reverse ACTGACTGGAGCTGGTAGGT Human NANOG Forward CAATGGTGTGACGCAGGGAT Human NANOG Reverse TGCACCAGGTCTGAGTGTTC Human OCT4 Forward CGAGAAGGATGTGGTCCGAG Human OCT4 Reverse GAGACAGGGGGAAAGGCTTC Human PPARG Forward GATACACTGTCTGCAAACATATCACAA Human PPARG Reverse CCACGGAGCTGATCCCAA Human FASN Forward TCGTGGGCTACAGCATGGT Human FASN Reverse GCCCTCTGAAGTCGAAGAAGAA Human ADIPOQ Forward TCTGCCTTCCGCAGTGTAGG Human ADIPOQ Reverse GGTGTGGCTTGGGGATACGA Human FABP4 Forward GCTTTGCCACCAGGAAAGTG Human FABP4 Reverse ATGGACGCATTCCACCACCA Mouse Myog Forward GTCCCAACCCAGGAGATCATT Mouse Myog Reverse AGTTGGGCATGGTTTCGTCT Mouse Myod1 Forward TGGCATGATGGATTACAGCGG Mouse Myod1 Reverse GGTGGTGCATCTGCCAAAAG mouse Myh3 Forward CTCTGTCACAGTCAGAGGTGT mouse Myh3 Reverse CTTTTCCGACTTGCGGAGGA mouse Myh8 Forward CTGAGGAGGCTGAGGAACAATC mouse Myh8 Reverse CCTCCTTCCTCTGCAAGATGT Mouse Actb Forward GGCTGTATTCCCCTCCATCG Mouse Actb Reverse CCAGTTGGTAACAATGCCATGT Open in a separate window Primer sequences Lentivirus-mediated gene delivery Lentivirus expression vector for the Article Title: Regulation of Myogenesis by a Na/K-ATPase α1 Caveolin Binding Motif Article Snippet: .. Lentivirus expression vector for the |